Journal: Current protocols in molecular biology

Article Title: Simple CRISPR-Cas9 Genome Editing in S. cerevisiae

doi: 10.1002/cpmb.110

Figure Lengend Snippet: Plasmid maps of the sgRNA/Cas9 expression vectors pML104 (URA3 marker) and pML107 (LEU2 marker). Both plasmids are yeast/E. coli shuttle vectors containing an ampicillin resistance (AmpR) marker, and a yeast 2 micron (2μ) origin of replication. Both vectors contain a Cas9 expression cassette and an sgRNA expression cassette, which contains unique BclI and SwaI restriction sites, to facilitate directional cloning of the user-designed guide sequence into the sgRNA expression cassette.

Article Snippet: Materials Yeast/ E. coli shuttle vectors containing both a guide RNA expression cassette and S. pyogenes Cas9: i.e., pML104 (Addgene #67638), pML107 (Addgene #67639) dam- strain of E. coli: i.e., New England Biolabs (NEB #C295I) Restriction enzymes SwaI (NEB #R0604S) and BclI (NEB #R0160S) 10x buffer compatible with both SwaI and BclI enzymes (i.e., NEB buffer 3.1) PCR thermal cycler Primers specific for user-designed guide RNA (100 pmol/μL) T4 DNA Ligase (NEB #M0202S) T4 DNA Ligase buffer (NEB) Competent E. coli cells (e.g., NEB #C2987I or similar) LB plates with 100 μg/ml ampicillin Plasmid Miniprep kit (i.e., Zymo Research D4036 or similar) T3 primer ( GCAATTAACCCTCACTAAAGG) LiAc-TE buffer (see recipe ) Design oligonucleotides containing guide RNA sequence list-behavior=enumerated prefix-word= mark-type=decimal max-label-size=0 Go to the CRISPR-Cas9 primer design website ( http://wyrickbioinfo2.smb.wsu.edu/crispr.html ) to design guide RNAs targeting a user-specified yeast gene.

Techniques: Plasmid Preparation, Expressing, Marker, Clone Assay, Sequencing

Journal: Current protocols in molecular biology

Article Title: Simple CRISPR-Cas9 Genome Editing in S. cerevisiae

doi: 10.1002/cpmb.110

Figure Lengend Snippet: Experimental strategy for cloning user-designed guide sequence into sgRNA expression cassette in pML104 or pML107. The BclI site is located at the 3’ end of the pSNR52 promoter, which is used to drive sgRNA expression in yeast. The SwaI site is located in the structural portion of the sgRNA. SwaI and BclI cleavage of the pML104 or pML107 sgRNA expression cassette results in a cut vector ready for ligation of the user designed guide sequence. The user-designed guide sequence contains a 20nt DNA region encoding the guide (for targeting Cas9; shown as N’s), a 5’ structural portion of the sgRNA, and a 5’ GATC overhang on one strand to facilitate ligation into the cleaved sgRNA expression cassette. Correct ligation can be validated by DNA sequencing using the neighboring T3 primer site. This figure is adapted from (Laughery et al., 2015).

Article Snippet: Materials Yeast/ E. coli shuttle vectors containing both a guide RNA expression cassette and S. pyogenes Cas9: i.e., pML104 (Addgene #67638), pML107 (Addgene #67639) dam- strain of E. coli: i.e., New England Biolabs (NEB #C295I) Restriction enzymes SwaI (NEB #R0604S) and BclI (NEB #R0160S) 10x buffer compatible with both SwaI and BclI enzymes (i.e., NEB buffer 3.1) PCR thermal cycler Primers specific for user-designed guide RNA (100 pmol/μL) T4 DNA Ligase (NEB #M0202S) T4 DNA Ligase buffer (NEB) Competent E. coli cells (e.g., NEB #C2987I or similar) LB plates with 100 μg/ml ampicillin Plasmid Miniprep kit (i.e., Zymo Research D4036 or similar) T3 primer ( GCAATTAACCCTCACTAAAGG) LiAc-TE buffer (see recipe ) Design oligonucleotides containing guide RNA sequence list-behavior=enumerated prefix-word= mark-type=decimal max-label-size=0 Go to the CRISPR-Cas9 primer design website ( http://wyrickbioinfo2.smb.wsu.edu/crispr.html ) to design guide RNAs targeting a user-specified yeast gene.

Techniques: Clone Assay, Sequencing, Expressing, Plasmid Preparation, Ligation, DNA Sequencing